Transcript: Mouse NM_013886.4

Mus musculus HDGF like 3 (Hdgfl3), mRNA.

Source:
NCBI, updated 2017-05-03
Taxon:
Mus musculus (mouse)
Gene:
Hdgfl3 (29877)
Length:
5868
CDS:
438..1046

Additional Resources:

NCBI RefSeq record:
NM_013886.4
NBCI Gene record:
Hdgfl3 (29877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013886.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313067 TAGGTGACTGCTCAACATAAT pLKO_005 1405 3UTR 100% 13.200 18.480 N Hdgfl3 n/a
2 TRCN0000313106 AGGGACCTAACTACCGTAATG pLKO_005 1037 CDS 100% 10.800 15.120 N Hdgfl3 n/a
3 TRCN0000095408 TCCAGCAAACAAGTACCCTAT pLKO.1 554 CDS 100% 4.050 5.670 N Hdgfl3 n/a
4 TRCN0000313065 ATAATCCAGGAGTGAAATTTA pLKO_005 706 CDS 100% 15.000 12.000 N Hdgfl3 n/a
5 TRCN0000095407 CGCTGGCAATGACACGAGAAA pLKO.1 986 CDS 100% 4.950 3.960 N Hdgfl3 n/a
6 TRCN0000095404 CCGTAATGAATGCTGCATATT pLKO.1 1050 3UTR 100% 13.200 9.240 N Hdgfl3 n/a
7 TRCN0000095405 CACGTCAAAGAAGTCTTCTAA pLKO.1 884 CDS 100% 5.625 3.938 N Hdgfl3 n/a
8 TRCN0000095406 GAAGAAGGTGATAGAGTAGAA pLKO.1 807 CDS 100% 4.950 3.465 N Hdgfl3 n/a
9 TRCN0000312125 GAAGAAGGTGATAGAGTAGAA pLKO_005 807 CDS 100% 4.950 3.465 N Hdgfl3 n/a
10 TRCN0000313105 GCTGGCAATGACACGAGAAAC pLKO_005 987 CDS 100% 10.800 6.480 N Hdgfl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013886.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.