Transcript: Mouse NM_013889.2

Mus musculus zinc finger protein 292 (Zfp292), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Zfp292 (30046)
Length:
9977
CDS:
30..8126

Additional Resources:

NCBI RefSeq record:
NM_013889.2
NBCI Gene record:
Zfp292 (30046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238452 TGTGGCAGTAAGCCATATATA pLKO_005 2262 CDS 100% 15.000 21.000 N Zfp292 n/a
2 TRCN0000238453 AGCGTGGGAAGCACGTGTATT pLKO_005 7036 CDS 100% 13.200 18.480 N Zfp292 n/a
3 TRCN0000099727 GAACCGAAACAATCAATGAAA pLKO.1 6450 CDS 100% 5.625 7.875 N Zfp292 n/a
4 TRCN0000238454 GTGAAAGAATGACCGTAATTT pLKO_005 9747 3UTR 100% 15.000 12.000 N Zfp292 n/a
5 TRCN0000238451 TGGTCTGGAAACCCGTGATAA pLKO_005 2756 CDS 100% 13.200 10.560 N Zfp292 n/a
6 TRCN0000238450 CATGGACAAGATGGCATATTA pLKO_005 3654 CDS 100% 15.000 10.500 N Zfp292 n/a
7 TRCN0000099726 CCAATAATAGTGCACATGTTT pLKO.1 4783 CDS 100% 5.625 3.938 N Zfp292 n/a
8 TRCN0000099729 CGCAACATTCTTATTGTCTTT pLKO.1 7218 CDS 100% 4.950 3.465 N Zfp292 n/a
9 TRCN0000099725 GCCATCTGGAAATGATGTGAA pLKO.1 2564 CDS 100% 4.950 3.465 N Zfp292 n/a
10 TRCN0000099728 GCCTTTATGATTTACCTCTTA pLKO.1 3166 CDS 100% 4.950 3.465 N Zfp292 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.