Transcript: Mouse NM_013903.2

Mus musculus matrix metallopeptidase 20 (enamelysin) (Mmp20), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mmp20 (30800)
Length:
3276
CDS:
23..1471

Additional Resources:

NCBI RefSeq record:
NM_013903.2
NBCI Gene record:
Mmp20 (30800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221439 GCCTATCTTGACAAGTATTAT pLKO.1 146 CDS 100% 15.000 21.000 N Mmp20 n/a
2 TRCN0000221437 GCACTGATGTACCCAACTTAT pLKO.1 743 CDS 100% 13.200 10.560 N Mmp20 n/a
3 TRCN0000221438 CCTCTGAACTTCGTTAGAATA pLKO.1 479 CDS 100% 13.200 9.240 N Mmp20 n/a
4 TRCN0000221440 CCAAGGCATGTGCAACGAATA pLKO.1 1181 CDS 100% 10.800 7.560 N Mmp20 n/a
5 TRCN0000221441 CCAGAATACAATGAATGTGAT pLKO.1 283 CDS 100% 4.950 3.465 N Mmp20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013903.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.