Transcript: Mouse NM_013910.2

Mus musculus lysine (K)-specific demethylase 2B (Kdm2b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Kdm2b (30841)
Length:
3541
CDS:
149..2479

Additional Resources:

NCBI RefSeq record:
NM_013910.2
NBCI Gene record:
Kdm2b (30841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342102 GCGTAGTCCACCTCGTGTTAT pLKO_005 1516 CDS 100% 13.200 18.480 N Kdm2b n/a
2 TRCN0000092541 TGCGGCTCATTATTCGCCATA pLKO.1 2157 CDS 100% 4.050 5.670 N Kdm2b n/a
3 TRCN0000092538 GCCTATTATTTCCCTTTGGAA pLKO.1 2557 3UTR 100% 3.000 2.400 N Kdm2b n/a
4 TRCN0000376184 CTGAGGAGGAAGCGGAAATAC pLKO_005 866 CDS 100% 13.200 9.240 N Kdm2b n/a
5 TRCN0000092540 GCGGCTCATTATTCGCCATAT pLKO.1 2158 CDS 100% 10.800 7.560 N Kdm2b n/a
6 TRCN0000327530 GCGGCTCATTATTCGCCATAT pLKO_005 2158 CDS 100% 10.800 7.560 N Kdm2b n/a
7 TRCN0000092539 CGCTGTGGAAATATCTGTCAT pLKO.1 2339 CDS 100% 4.950 3.465 N Kdm2b n/a
8 TRCN0000363562 CGCTGTGGAAATATCTGTCAT pLKO_005 2339 CDS 100% 4.950 3.465 N Kdm2b n/a
9 TRCN0000092542 GCTGTGGAAATATCTGTCATA pLKO.1 2340 CDS 100% 4.950 3.465 N Kdm2b n/a
10 TRCN0000118438 CCTTCTTCAAACGCTGTGGAA pLKO.1 2328 CDS 100% 2.640 1.848 N KDM2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013910.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.