Transcript: Human NM_014345.3

Homo sapiens zinc finger protein 318 (ZNF318), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ZNF318 (24149)
Length:
8210
CDS:
283..7122

Additional Resources:

NCBI RefSeq record:
NM_014345.3
NBCI Gene record:
ZNF318 (24149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133950 CCATTCCATCACTCATAAGAT pLKO.1 2879 CDS 100% 5.625 7.875 N ZNF318 n/a
2 TRCN0000134392 GCTACTTGTGAGTGAATCATT pLKO.1 7138 3UTR 100% 5.625 7.875 N ZNF318 n/a
3 TRCN0000163260 GCAACTATCGACAGCGTAGAA pLKO.1 1172 CDS 100% 4.950 6.930 N ZNF318 n/a
4 TRCN0000158790 GCTGCTTATGAGTATTATGAT pLKO.1 3448 CDS 100% 5.625 4.500 N ZNF318 n/a
5 TRCN0000160410 CCTGCCTTAACATTGTTTGAA pLKO.1 7645 3UTR 100% 5.625 3.938 N ZNF318 n/a
6 TRCN0000158681 GCAGTCAGCATCTTAAAGTAA pLKO.1 7232 3UTR 100% 5.625 3.938 N ZNF318 n/a
7 TRCN0000159270 GAGCAGGTAATTGAAGACAAT pLKO.1 7021 CDS 100% 4.950 3.465 N ZNF318 n/a
8 TRCN0000159089 GCTGTAAAGCTAGAATCACTA pLKO.1 2008 CDS 100% 4.950 3.465 N ZNF318 n/a
9 TRCN0000137281 GCAAGTCATGTTCAGCCACAA pLKO.1 4361 CDS 100% 4.050 2.835 N ZNF318 n/a
10 TRCN0000164087 CCACCTCCTCAACTGTTAGAT pLKO.1 5473 CDS 100% 5.625 3.375 N ZNF318 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.