Transcript: Human NM_014364.5

Homo sapiens glyceraldehyde-3-phosphate dehydrogenase, spermatogenic (GAPDHS), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GAPDHS (26330)
Length:
1448
CDS:
73..1299

Additional Resources:

NCBI RefSeq record:
NM_014364.5
NBCI Gene record:
GAPDHS (26330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436776 TACGGACTTCCTCGGTGATAC pLKO_005 1137 CDS 100% 10.800 15.120 N GAPDHS n/a
2 TRCN0000026457 CTCGTCCATCTTCGATGCTAA pLKO.1 1161 CDS 100% 4.950 6.930 N GAPDHS n/a
3 TRCN0000415340 ACACCAGTCAGGGAGGAAATA pLKO_005 205 CDS 100% 13.200 9.240 N GAPDHS n/a
4 TRCN0000026480 TCATGGTACGACAACGAATAT pLKO.1 1222 CDS 100% 13.200 9.240 N GAPDHS n/a
5 TRCN0000436729 AGCTGACTGTGGGCATCAATG pLKO_005 296 CDS 100% 10.800 7.560 N GAPDHS n/a
6 TRCN0000026501 CCCGGAATACATGGTGTACAT pLKO.1 402 CDS 100% 4.950 3.465 N GAPDHS n/a
7 TRCN0000026429 CCTGAGCCTAAGGCTGAAGTA pLKO.1 160 CDS 100% 4.950 3.465 N GAPDHS n/a
8 TRCN0000026481 GCTGTGAATGATCCATTCATT pLKO.1 379 CDS 100% 0.563 0.394 N GAPDHS n/a
9 TRCN0000430444 TGCATGGAGAAGGGTGTTAAG pLKO_005 352 CDS 100% 10.800 6.480 N GAPDHS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014364.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.