Transcript: Human NM_014376.4

Homo sapiens cytoplasmic FMR1 interacting protein 2 (CYFIP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CYFIP2 (26999)
Length:
6639
CDS:
284..4045

Additional Resources:

NCBI RefSeq record:
NM_014376.4
NBCI Gene record:
CYFIP2 (26999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014376.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242604 TCATGTACCAGGCTAACTTTG pLKO_005 390 CDS 100% 10.800 15.120 N CYFIP2 n/a
2 TRCN0000242602 ACTGTCAAATGTACCATATTT pLKO_005 6407 3UTR 100% 15.000 10.500 N CYFIP2 n/a
3 TRCN0000244625 CAGCTGTTGGGTAGATCAATT pLKO_005 2546 CDS 100% 13.200 9.240 N CYFIP2 n/a
4 TRCN0000242601 ACAACGACAGCGCCTACTATG pLKO_005 2292 CDS 100% 10.800 7.560 N CYFIP2 n/a
5 TRCN0000180785 GCTGGCTGACATTGTCAACAT pLKO.1 994 CDS 100% 4.950 3.465 N CYFIP2 n/a
6 TRCN0000181001 GCCTCTACCTAATGGATGGAA pLKO.1 1092 CDS 100% 3.000 2.100 N CYFIP2 n/a
7 TRCN0000242603 TGCTGTCCTGGATGAGCTAAA pLKO_005 787 CDS 100% 10.800 6.480 N CYFIP2 n/a
8 TRCN0000097701 CCTGGATTCTAACGGACCATA pLKO.1 2214 CDS 100% 4.950 2.970 N Cyfip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014376.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.