Transcript: Human NM_014390.4

Homo sapiens staphylococcal nuclease and tudor domain containing 1 (SND1), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SND1 (27044)
Length:
3448
CDS:
181..2913

Additional Resources:

NCBI RefSeq record:
NM_014390.4
NBCI Gene record:
SND1 (27044)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245142 TCTCGTCTCAAACTCTATTTG pLKO_005 1792 CDS 100% 13.200 18.480 N SND1 n/a
2 TRCN0000049656 CGGGATCTCAAGTATACCATT pLKO.1 700 CDS 100% 4.950 6.930 N SND1 n/a
3 TRCN0000245144 TAGTGGAGGGAGTAATCCTAA pLKO_005 3232 3UTR 100% 4.950 6.930 N SND1 n/a
4 TRCN0000245140 GAAGGCATGAGAGCTAATAAT pLKO_005 589 CDS 100% 15.000 12.000 N SND1 n/a
5 TRCN0000245141 TGTGGCTCCCACAGCTAATTT pLKO_005 1167 CDS 100% 15.000 10.500 N SND1 n/a
6 TRCN0000049657 GCTGATGATGCAGACGAATTT pLKO.1 2878 CDS 100% 13.200 9.240 N SND1 n/a
7 TRCN0000245143 GCTGATGATGCAGACGAATTT pLKO_005 2878 CDS 100% 13.200 9.240 N SND1 n/a
8 TRCN0000049654 GCGAGAGTATGGCATGATCTA pLKO.1 498 CDS 100% 4.950 3.465 N SND1 n/a
9 TRCN0000054740 GCCAAATTTGTAGATGGAGAA pLKO.1 2392 CDS 100% 4.050 2.835 N Snd1 n/a
10 TRCN0000049653 CCCACAGCTAATTTGGACCAA pLKO.1 1174 CDS 100% 2.640 1.848 N SND1 n/a
11 TRCN0000049655 GCCAAAGGAAACTTGCCTTAT pLKO.1 1812 CDS 100% 10.800 6.480 N SND1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014390.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.