Transcript: Human NM_014461.4

Homo sapiens contactin 6 (CNTN6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CNTN6 (27255)
Length:
4074
CDS:
189..3275

Additional Resources:

NCBI RefSeq record:
NM_014461.4
NBCI Gene record:
CNTN6 (27255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014461.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073403 CCCTCCATTGAAGTGGTATTT pLKO.1 1767 CDS 100% 13.200 18.480 N CNTN6 n/a
2 TRCN0000427837 TTATCTGCAGTAGCCGATATC pLKO_005 1944 CDS 100% 10.800 15.120 N CNTN6 n/a
3 TRCN0000073406 CCAGATAATAACAGTCCCATT pLKO.1 2052 CDS 100% 4.050 5.670 N CNTN6 n/a
4 TRCN0000073405 CCATCTACTTTGCTTCCGTAA pLKO.1 2806 CDS 100% 4.050 3.240 N CNTN6 n/a
5 TRCN0000412872 GTGAACCATCAGAATTGTTAA pLKO_005 2248 CDS 100% 13.200 9.240 N CNTN6 n/a
6 TRCN0000427062 GTTACAGTTGGCGAGAGTATA pLKO_005 1719 CDS 100% 13.200 9.240 N CNTN6 n/a
7 TRCN0000422095 TTGCAAAGGGTCAACTCATTT pLKO_005 1108 CDS 100% 13.200 9.240 N CNTN6 n/a
8 TRCN0000073407 CGATGCTGAATGTGTCAGATT pLKO.1 1309 CDS 100% 4.950 3.465 N CNTN6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014461.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.