Transcript: Human NM_014503.3

Homo sapiens UTP20 small subunit processome component (UTP20), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
UTP20 (27340)
Length:
9031
CDS:
179..8536

Additional Resources:

NCBI RefSeq record:
NM_014503.3
NBCI Gene record:
UTP20 (27340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144408 CGAATCACAGTGGGATTAATT pLKO.1 6194 CDS 100% 15.000 21.000 N UTP20 n/a
2 TRCN0000431319 TCGTGGTGTTACCTCATATTA pLKO_005 1743 CDS 100% 15.000 21.000 N UTP20 n/a
3 TRCN0000446317 GCGCATACCTGCCGAAGATTT pLKO_005 3516 CDS 100% 13.200 18.480 N UTP20 n/a
4 TRCN0000433085 GTCGTCAGCACGGTATCTTAA pLKO_005 3453 CDS 100% 13.200 18.480 N UTP20 n/a
5 TRCN0000122661 GCTGACTTTCACCGTTCACAT pLKO.1 5878 CDS 100% 4.950 6.930 N UTP20 n/a
6 TRCN0000145432 GCTTCGTTATTTGTTAGGCAT pLKO.1 2338 CDS 100% 2.640 3.696 N UTP20 n/a
7 TRCN0000143490 GCCTTGAATGTCACAGAGAAA pLKO.1 4694 CDS 100% 4.950 3.960 N UTP20 n/a
8 TRCN0000121824 GCATGAACTTTCTGGAATATT pLKO.1 8558 3UTR 100% 15.000 10.500 N UTP20 n/a
9 TRCN0000122102 CCAAGTTACAAGCAAACATTT pLKO.1 2073 CDS 100% 13.200 9.240 N UTP20 n/a
10 TRCN0000144441 CGAGATAGTTCAGAGTTTGAA pLKO.1 436 CDS 100% 5.625 3.938 N UTP20 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8886 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8886 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.