Transcript: Human NM_014633.5

Homo sapiens CTR9 homolog, Paf1/RNA polymerase II complex component (CTR9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CTR9 (9646)
Length:
4330
CDS:
168..3689

Additional Resources:

NCBI RefSeq record:
NM_014633.5
NBCI Gene record:
CTR9 (9646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014633.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008737 CGTGCAAATGAGACTATTCTT pLKO.1 3878 3UTR 100% 5.625 7.875 N CTR9 n/a
2 TRCN0000293394 CGTGCAAATGAGACTATTCTT pLKO_005 3878 3UTR 100% 5.625 7.875 N CTR9 n/a
3 TRCN0000008740 GCAGCACGTATAGATGGCAAT pLKO.1 363 CDS 100% 4.050 5.670 N CTR9 n/a
4 TRCN0000293391 GCAGCACGTATAGATGGCAAT pLKO_005 363 CDS 100% 4.050 5.670 N CTR9 n/a
5 TRCN0000008739 CCTCCAGAGATTCTCAATAAT pLKO.1 1515 CDS 100% 15.000 12.000 N CTR9 n/a
6 TRCN0000293327 CCTCCAGAGATTCTCAATAAT pLKO_005 1515 CDS 100% 15.000 12.000 N CTR9 n/a
7 TRCN0000249706 AGAAGTTTGAGAGGATATTAA pLKO_005 1924 CDS 100% 15.000 10.500 N Ctr9 n/a
8 TRCN0000008738 GCACGCAAACAAGATGAAGAA pLKO.1 2658 CDS 100% 4.950 3.465 N CTR9 n/a
9 TRCN0000293328 GCACGCAAACAAGATGAAGAA pLKO_005 2658 CDS 100% 4.950 3.465 N CTR9 n/a
10 TRCN0000008741 GCCATAATTTCATCAAGTGAT pLKO.1 3201 CDS 100% 4.950 3.465 N CTR9 n/a
11 TRCN0000293392 GCCATAATTTCATCAAGTGAT pLKO_005 3201 CDS 100% 4.950 3.465 N CTR9 n/a
12 TRCN0000194617 GCGCTGGAATACTACAAGCAA pLKO.1 309 CDS 100% 3.000 1.800 N Ctr9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014633.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.