Transcript: Human NM_014709.4

Homo sapiens ubiquitin specific peptidase 34 (USP34), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
USP34 (9736)
Length:
11675
CDS:
396..11036

Additional Resources:

NCBI RefSeq record:
NM_014709.4
NBCI Gene record:
USP34 (9736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038845 GCGACTTATGTCTGTTGCTTA pLKO.1 5183 CDS 100% 4.950 6.930 N USP34 n/a
2 TRCN0000038847 GCTCGTAACATGGCTGACTTA pLKO.1 1260 CDS 100% 4.950 6.930 N USP34 n/a
3 TRCN0000230380 ACCCTACTATTGAGGATATAT pLKO_005 934 CDS 100% 15.000 12.000 N USP34 n/a
4 TRCN0000230382 GCGACTGAGTACTCAACATAT pLKO_005 1601 CDS 100% 13.200 10.560 N USP34 n/a
5 TRCN0000038846 GCGAATTGAATTTGCCCATAA pLKO.1 9473 CDS 100% 10.800 8.640 N USP34 n/a
6 TRCN0000218310 ACAATGTGGTGGAGCATATAT pLKO_005 1510 CDS 100% 15.000 10.500 N USP34 n/a
7 TRCN0000230381 CTTATAGCACATGCGTTTATT pLKO_005 1113 CDS 100% 15.000 10.500 N USP34 n/a
8 TRCN0000038844 CCAGAGAATATCCGCCTTATT pLKO.1 8832 CDS 100% 13.200 9.240 N USP34 n/a
9 TRCN0000038848 GCAGATATTGAAGCCCTCAAA pLKO.1 2238 CDS 100% 4.950 3.465 N USP34 n/a
10 TRCN0000230383 GCTGTGGCCTGGCAGTATATA pLKO_005 11513 3UTR 100% 15.000 9.000 N USP34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.