Transcript: Human NM_014730.4

Homo sapiens malectin (MLEC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MLEC (9761)
Length:
6341
CDS:
149..1027

Additional Resources:

NCBI RefSeq record:
NM_014730.4
NBCI Gene record:
MLEC (9761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014730.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061883 GCCTCAGACTATGGCATGAAA pLKO.1 383 CDS 100% 5.625 7.875 N MLEC n/a
2 TRCN0000291390 GCCTCAGACTATGGCATGAAA pLKO_005 383 CDS 100% 5.625 7.875 N MLEC n/a
3 TRCN0000061885 CCTGTATCAAACTGAGCGGTA pLKO.1 439 CDS 100% 2.160 3.024 N MLEC n/a
4 TRCN0000061887 GAATATGATGAAGGGTCTAAT pLKO.1 860 CDS 100% 13.200 10.560 N MLEC n/a
5 TRCN0000291386 GAATATGATGAAGGGTCTAAT pLKO_005 860 CDS 100% 13.200 10.560 N MLEC n/a
6 TRCN0000061886 CGTGGTGAAGGACTTGGATAT pLKO.1 592 CDS 100% 10.800 7.560 N MLEC n/a
7 TRCN0000291388 CGTGGTGAAGGACTTGGATAT pLKO_005 592 CDS 100% 10.800 7.560 N MLEC n/a
8 TRCN0000061884 CCGGGATTGGAGAAGAAAGAA pLKO.1 821 CDS 100% 5.625 3.938 N MLEC n/a
9 TRCN0000291391 CCGGGATTGGAGAAGAAAGAA pLKO_005 821 CDS 100% 5.625 3.938 N MLEC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014730.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.