Transcript: Human NM_014817.4

Homo sapiens TLR4 interactor with leucine rich repeats (TRIL), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
TRIL (9865)
Length:
4973
CDS:
285..2720

Additional Resources:

NCBI RefSeq record:
NM_014817.4
NBCI Gene record:
TRIL (9865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183073 CGAGGATAACTAAGATTACAT pLKO.1 3441 3UTR 100% 5.625 7.875 N TRIL n/a
2 TRCN0000148264 GCAACTTCATAACCAACATCA pLKO.1 487 CDS 100% 4.950 6.930 N TRIL n/a
3 TRCN0000181059 CATAACCAACATCACGGCCTT pLKO.1 494 CDS 100% 2.160 1.728 N TRIL n/a
4 TRCN0000448064 GAAGGAACTTATTACCATTAC pLKO_005 3132 3UTR 100% 10.800 7.560 N TRIL n/a
5 TRCN0000441554 GACTAGGTCCAGGGCATATAG pLKO_005 2715 CDS 100% 13.200 7.920 N TRIL n/a
6 TRCN0000181029 CCCATGCGACTTCAACAAGTT pLKO.1 2018 CDS 100% 4.950 2.970 N TRIL n/a
7 TRCN0000146946 CAACAAGTTCATTCTGTGCAA pLKO.1 2030 CDS 100% 2.640 1.584 N TRIL n/a
8 TRCN0000201889 CTGGATTACCTGGATGACCAA pLKO.1 1485 CDS 100% 2.640 1.848 N Tril n/a
9 TRCN0000339612 CTGGATTACCTGGATGACCAA pLKO_005 1485 CDS 100% 2.640 1.848 N Tril n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014817.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.