Transcript: Human NM_014825.3

Homo sapiens URB1 ribosome biogenesis homolog (URB1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
URB1 (9875)
Length:
10818
CDS:
103..6918

Additional Resources:

NCBI RefSeq record:
NM_014825.3
NBCI Gene record:
URB1 (9875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338988 ACACAGCCTTATCCCTTATTT pLKO_005 1460 CDS 100% 15.000 21.000 N URB1 n/a
2 TRCN0000339056 GATGTTGTGGAAGGGTATATA pLKO_005 298 CDS 100% 15.000 10.500 N URB1 n/a
3 TRCN0000338986 GCGAAGTCTACTTGGTTAAAT pLKO_005 1258 CDS 100% 15.000 10.500 N URB1 n/a
4 TRCN0000339054 GGAAATGCTGCTTAGATTAAA pLKO_005 4329 CDS 100% 15.000 10.500 N URB1 n/a
5 TRCN0000338989 ATGAACAGATTCACCGTAAAT pLKO_005 5989 CDS 100% 13.200 9.240 N URB1 n/a
6 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 7371 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014825.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.