Transcript: Human NM_014861.3

Homo sapiens ATPase secretory pathway Ca2+ transporting 2 (ATP2C2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ATP2C2 (9914)
Length:
3407
CDS:
94..2934

Additional Resources:

NCBI RefSeq record:
NM_014861.3
NBCI Gene record:
ATP2C2 (9914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050390 GCTGATATTTGAGATCGGCTT pLKO.1 2679 CDS 100% 2.160 3.024 N ATP2C2 n/a
2 TRCN0000050391 CGGAGAAGTGTTTAAGATGAT pLKO.1 903 CDS 100% 4.950 3.960 N ATP2C2 n/a
3 TRCN0000050392 GCGAACCTGTGTGGAAGAAAT pLKO.1 389 CDS 100% 13.200 9.240 N ATP2C2 n/a
4 TRCN0000050389 CGGGTCATCGTGAAGAAGTTA pLKO.1 1165 CDS 100% 5.625 3.938 N ATP2C2 n/a
5 TRCN0000050388 CCTAATCATCTCGATCTGGTT pLKO.1 2959 3UTR 100% 2.640 1.848 N ATP2C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014861.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.