Transcript: Human NM_014874.4

Homo sapiens mitofusin 2 (MFN2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
MFN2 (9927)
Length:
4407
CDS:
191..2464

Additional Resources:

NCBI RefSeq record:
NM_014874.4
NBCI Gene record:
MFN2 (9927)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014874.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082684 GCAGGTTTACTGCGAGGAAAT pLKO.1 1348 CDS 100% 10.800 15.120 N MFN2 n/a
2 TRCN0000082683 GCTCAGTGCTTCATCCCATTT pLKO.1 2974 3UTR 100% 10.800 15.120 N MFN2 n/a
3 TRCN0000082687 GTCAAAGGTTACCTATCCAAA pLKO.1 422 CDS 100% 4.950 6.930 N MFN2 n/a
4 TRCN0000082686 GCACTTTGTCACTGCCAAGAA pLKO.1 280 CDS 100% 4.950 3.465 N MFN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014874.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.