Transcript: Human NM_015020.3

Homo sapiens PH domain and leucine rich repeat protein phosphatase 2 (PHLPP2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PHLPP2 (23035)
Length:
8317
CDS:
380..4351

Additional Resources:

NCBI RefSeq record:
NM_015020.3
NBCI Gene record:
PHLPP2 (23035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082660 GCCTGAACTTGTCCCATAATA pLKO.1 1287 CDS 100% 15.000 21.000 N PHLPP2 n/a
2 TRCN0000291112 GCCTGAACTTGTCCCATAATA pLKO_005 1287 CDS 100% 15.000 21.000 N PHLPP2 n/a
3 TRCN0000082661 GCCTCGATACACTCTACAAAT pLKO.1 1251 CDS 100% 13.200 18.480 N PHLPP2 n/a
4 TRCN0000291111 GCCTCGATACACTCTACAAAT pLKO_005 1251 CDS 100% 13.200 18.480 N PHLPP2 n/a
5 TRCN0000082659 CCTCTTCAGATCGTTTATGAT pLKO.1 686 CDS 100% 5.625 7.875 N PHLPP2 n/a
6 TRCN0000291170 CCTCTTCAGATCGTTTATGAT pLKO_005 686 CDS 100% 5.625 7.875 N PHLPP2 n/a
7 TRCN0000082658 GCTAGGTATTTCCCAGGGAAA pLKO.1 5528 3UTR 100% 4.050 5.670 N PHLPP2 n/a
8 TRCN0000291169 GCTAGGTATTTCCCAGGGAAA pLKO_005 5528 3UTR 100% 4.050 5.670 N PHLPP2 n/a
9 TRCN0000082662 CTGCTTTATCTGACCAACAAT pLKO.1 2249 CDS 100% 5.625 3.938 N PHLPP2 n/a
10 TRCN0000291168 CTGCTTTATCTGACCAACAAT pLKO_005 2249 CDS 100% 5.625 3.938 N PHLPP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.