Transcript: Human NM_015029.2

Homo sapiens POP1 homolog, ribonuclease P/MRP subunit (POP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
POP1 (10940)
Length:
4689
CDS:
29..3103

Additional Resources:

NCBI RefSeq record:
NM_015029.2
NBCI Gene record:
POP1 (10940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433428 CAGTATAAGAGGTCGCCTAAT pLKO_005 1982 CDS 100% 10.800 15.120 N POP1 n/a
2 TRCN0000049890 GCTTACGAAGAACCTTCTGTA pLKO.1 2189 CDS 100% 4.950 6.930 N POP1 n/a
3 TRCN0000415670 GAAATTCCGGCAGGTACTATT pLKO_005 1520 CDS 100% 13.200 10.560 N POP1 n/a
4 TRCN0000049889 GCGGTTTCATATGGTCAAGAA pLKO.1 658 CDS 100% 0.000 0.000 N POP1 n/a
5 TRCN0000432341 CTCCAACCACAGGCATTATAA pLKO_005 1272 CDS 100% 15.000 10.500 N POP1 n/a
6 TRCN0000412504 GGCATAGATAATACGTTATTA pLKO_005 3126 3UTR 100% 15.000 10.500 N POP1 n/a
7 TRCN0000431968 AGGGCTTGTCAGGTCTATTTG pLKO_005 3426 3UTR 100% 13.200 9.240 N POP1 n/a
8 TRCN0000049888 CCATCCTAACTGAAGCAATAA pLKO.1 1350 CDS 100% 13.200 9.240 N POP1 n/a
9 TRCN0000436972 GTGGCTGACAGAGGTGTAAAG pLKO_005 107 CDS 100% 10.800 7.560 N POP1 n/a
10 TRCN0000049892 GCTTTGTGACTCAGGGAGATT pLKO.1 2922 CDS 100% 4.950 3.465 N POP1 n/a
11 TRCN0000049891 CCTTGTGCTTTATCGGGTGAA pLKO.1 901 CDS 100% 4.050 2.835 N POP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.