Transcript: Human NM_015056.3

Homo sapiens ribosomal RNA processing 1B (RRP1B), mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
RRP1B (23076)
Length:
5078
CDS:
106..2382

Additional Resources:

NCBI RefSeq record:
NM_015056.3
NBCI Gene record:
RRP1B (23076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130351 GATGACCAAATCCTCAGTCAA pLKO.1 1165 CDS 100% 4.950 6.930 N RRP1B n/a
2 TRCN0000312493 GATGACCAAATCCTCAGTCAA pLKO_005 1165 CDS 100% 4.950 6.930 N RRP1B n/a
3 TRCN0000131094 GTCAAACTTGGTGGAGCACAA pLKO.1 1911 CDS 100% 4.050 3.240 N RRP1B n/a
4 TRCN0000129332 CCTGAGAGTCAGTCTCCTAAT pLKO.1 571 CDS 100% 10.800 7.560 N RRP1B n/a
5 TRCN0000349728 CCTGAGAGTCAGTCTCCTAAT pLKO_005 571 CDS 100% 10.800 7.560 N RRP1B n/a
6 TRCN0000371001 GCAAACCATGAATCGAGAATG pLKO_005 402 CDS 100% 10.800 7.560 N RRP1B n/a
7 TRCN0000370945 TTGAAGTCTTGAAGCGAAATG pLKO_005 491 CDS 100% 10.800 7.560 N RRP1B n/a
8 TRCN0000131097 GACTTGCAGTTCCCTGAAGAA pLKO.1 1983 CDS 100% 4.950 3.465 N RRP1B n/a
9 TRCN0000130433 GCACATTTGTTCTGCAGACTA pLKO.1 4313 3UTR 100% 4.950 3.465 N RRP1B n/a
10 TRCN0000349729 GCACATTTGTTCTGCAGACTA pLKO_005 4313 3UTR 100% 4.950 3.465 N RRP1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.