Transcript: Human NM_015063.3

Homo sapiens solute carrier family 8 member A2 (SLC8A2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC8A2 (6543)
Length:
4959
CDS:
122..2887

Additional Resources:

NCBI RefSeq record:
NM_015063.3
NBCI Gene record:
SLC8A2 (6543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054065 GTGGATAAACTCATCAAGAAA pLKO.1 2138 CDS 100% 5.625 3.938 N SLC8A2 n/a
2 TRCN0000054066 CATCGAGGTCATCACGTCAAA pLKO.1 409 CDS 100% 4.950 3.465 N SLC8A2 n/a
3 TRCN0000054063 CCTTGGTAATTGGGACCCATT pLKO.1 2169 CDS 100% 4.050 2.835 N SLC8A2 n/a
4 TRCN0000054064 GTCTGGCTTTATCTCATCCTT pLKO.1 749 CDS 100% 3.000 2.100 N SLC8A2 n/a
5 TRCN0000054067 CTCTGTCAATGCTGTTGTCTT pLKO.1 2464 CDS 100% 4.950 2.970 N SLC8A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.