Transcript: Human NM_015094.3

Homo sapiens HIC ZBTB transcriptional repressor 2 (HIC2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
HIC2 (23119)
Length:
6831
CDS:
264..2111

Additional Resources:

NCBI RefSeq record:
NM_015094.3
NBCI Gene record:
HIC2 (23119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015094.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236349 ACGTTTGTGCGACATAGTATT pLKO_005 4440 3UTR 100% 13.200 18.480 N HIC2 n/a
2 TRCN0000108137 CATGCGCTTCACCCGTCAGTA pLKO.1 1964 CDS 100% 1.650 2.310 N HIC2 n/a
3 TRCN0000236348 TGCCAACAGTGCCTCTTATTC pLKO_005 1130 CDS 100% 13.200 10.560 N HIC2 n/a
4 TRCN0000108138 CCGGCACTCCACTCGGAAGAA pLKO.1 1253 CDS 100% 0.000 0.000 N HIC2 n/a
5 TRCN0000236350 AGCCGCCAGCAGCATCTATTT pLKO_005 455 CDS 100% 13.200 9.240 N HIC2 n/a
6 TRCN0000236347 CTGTCATCCAAGCTCGGTATC pLKO_005 769 CDS 100% 6.000 4.200 N HIC2 n/a
7 TRCN0000108139 CGCCAGCAGCATCTATTTCAA pLKO.1 458 CDS 100% 5.625 3.938 N HIC2 n/a
8 TRCN0000236351 AGTGTTCGGTCTGCGAGAAGA pLKO_005 1780 CDS 100% 4.950 3.465 N HIC2 n/a
9 TRCN0000108135 CCTTGCTATTTATTGCTGTAA pLKO.1 6273 3UTR 100% 4.950 3.465 N HIC2 n/a
10 TRCN0000108136 TCTGTCATCCAAGCTCGGTAT pLKO.1 768 CDS 100% 4.050 2.835 N HIC2 n/a
11 TRCN0000032491 GCCTCTTATTCTGAGCTGGAA pLKO.1 1140 CDS 100% 2.640 1.584 N Dpep2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015094.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.