Transcript: Human NM_015136.3

Homo sapiens stabilin 1 (STAB1), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
STAB1 (23166)
Length:
7928
CDS:
77..7789

Additional Resources:

NCBI RefSeq record:
NM_015136.3
NBCI Gene record:
STAB1 (23166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160905 GCTCACGTATAAGACACTCTT pLKO.1 7162 CDS 100% 4.950 6.930 N STAB1 n/a
2 TRCN0000161067 GCAGACGTTCAACATCTACAA pLKO.1 1486 CDS 100% 4.950 3.960 N STAB1 n/a
3 TRCN0000163656 GCTGGGAGATTCGCAACATTA pLKO.1 3321 CDS 100% 13.200 9.240 N STAB1 n/a
4 TRCN0000159570 CAACTCTACTTTGTGTGTGTA pLKO.1 931 CDS 100% 4.950 3.465 N STAB1 n/a
5 TRCN0000163204 GTGCTGTTCAAAGGCTGTGAT pLKO.1 155 CDS 100% 4.950 3.465 N STAB1 n/a
6 TRCN0000162622 CCTGGAATATAAGGAGCTCAA pLKO.1 4882 CDS 100% 4.050 2.835 N STAB1 n/a
7 TRCN0000163231 GTCCCTGTCAATGAAGGCTTT pLKO.1 7184 CDS 100% 4.050 2.835 N STAB1 n/a
8 TRCN0000164241 CCACATGATTCGCAATGTCGA pLKO.1 5467 CDS 100% 2.640 1.848 N STAB1 n/a
9 TRCN0000163973 CCTGCGGGAGAAATGTGTAAA pLKO.1 3877 CDS 100% 13.200 7.920 N STAB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.