Transcript: Human NM_015164.4

Homo sapiens pleckstrin homology and RUN domain containing M2 (PLEKHM2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PLEKHM2 (23207)
Length:
4134
CDS:
240..3299

Additional Resources:

NCBI RefSeq record:
NM_015164.4
NBCI Gene record:
PLEKHM2 (23207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015164.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239317 ACCAGCTTCTTCCGCTCTTTG pLKO_005 2958 CDS 100% 10.800 15.120 N PLEKHM2 n/a
2 TRCN0000239318 AGCCATCCTTGTTCGTGTTTG pLKO_005 3715 3UTR 100% 10.800 8.640 N PLEKHM2 n/a
3 TRCN0000239316 TCACGGATGACCGCCTCTTTA pLKO_005 2917 CDS 100% 13.200 9.240 N PLEKHM2 n/a
4 TRCN0000239315 CAATGGACTTCTACCGCTTTA pLKO_005 1621 CDS 100% 10.800 7.560 N PLEKHM2 n/a
5 TRCN0000239319 TGAAGTCAGCCATGATCAAAG pLKO_005 2332 CDS 100% 10.800 6.480 N PLEKHM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015164.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.