Transcript: Human NM_015201.5

Homo sapiens BOP1 ribosomal biogenesis factor (BOP1), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
BOP1 (23246)
Length:
2428
CDS:
69..2309

Additional Resources:

NCBI RefSeq record:
NM_015201.5
NBCI Gene record:
BOP1 (23246)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015201.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078069 CTTGGAGTGGTACGATGACTT pLKO.1 488 CDS 100% 4.950 6.930 N BOP1 n/a
2 TRCN0000078071 GATAGCAAGCTGGTGTGGTTT pLKO.1 1989 CDS 100% 4.950 6.930 N BOP1 n/a
3 TRCN0000078072 CGCCACAAGATGCACGTACCT pLKO.1 951 CDS 100% 0.880 1.232 N BOP1 n/a
4 TRCN0000364622 CGAGGGCCACAGTGGGATTAA pLKO_005 332 CDS 100% 4.400 3.520 N BOP1 n/a
5 TRCN0000369258 GCCATGGCATGGTGTACAATG pLKO_005 2137 CDS 100% 10.800 7.560 N BOP1 n/a
6 TRCN0000078070 CAGCGCAAGATGAGGGTGAAT pLKO.1 1194 CDS 100% 4.950 3.465 N BOP1 n/a
7 TRCN0000369256 CTGCAGGTGACAACGTCATCT pLKO_005 1957 CDS 100% 4.950 3.465 N BOP1 n/a
8 TRCN0000376489 GTGACAGCAGTGAGGATGATG pLKO_005 271 CDS 100% 4.950 3.465 N BOP1 n/a
9 TRCN0000222737 GTGTGGTTTGACCTGGATCTT pLKO.1 2001 CDS 100% 4.950 3.465 N BOP1 n/a
10 TRCN0000369257 ATGAGGAGGACATCCGGAACA pLKO_005 451 CDS 100% 4.050 2.835 N BOP1 n/a
11 TRCN0000364623 TGTGTTCTCAGGCCTGGAAGA pLKO_005 242 CDS 100% 4.050 2.835 N BOP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015201.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.