Transcript: Human NM_015206.3

Homo sapiens membrane integral NOTCH2 associated receptor 1 (MINAR1), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MINAR1 (23251)
Length:
6926
CDS:
256..3006

Additional Resources:

NCBI RefSeq record:
NM_015206.3
NBCI Gene record:
MINAR1 (23251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424407 GTCGGGTGTCCGTGATGAAAT pLKO_005 2094 CDS 100% 13.200 18.480 N MINAR1 n/a
2 TRCN0000144107 CCAGGATACGATTCATTACTA pLKO.1 2866 CDS 100% 5.625 7.875 N MINAR1 n/a
3 TRCN0000417504 AGCTTTGAAATGCCCTATAAC pLKO_005 1162 CDS 100% 13.200 9.240 N MINAR1 n/a
4 TRCN0000140721 GCCTCAATGAGGAGGAGATAA pLKO.1 2483 CDS 100% 13.200 9.240 N MINAR1 n/a
5 TRCN0000141487 CCTGAGCACAACTTAACCAAA pLKO.1 1933 CDS 100% 4.950 3.465 N MINAR1 n/a
6 TRCN0000141892 GCAGCAGATATTGTGACGATA pLKO.1 505 CDS 100% 4.950 3.465 N MINAR1 n/a
7 TRCN0000140003 GCGCACCATCACTTATACCAA pLKO.1 2454 CDS 100% 3.000 2.100 N MINAR1 n/a
8 TRCN0000139069 CCCAAACTAGAGAACAACCCT pLKO.1 2272 CDS 100% 0.750 0.525 N MINAR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015206.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.