Transcript: Human NM_015243.2

Homo sapiens vacuolar protein sorting 13 homolog B (VPS13B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
VPS13B (157680)
Length:
2822
CDS:
112..2703

Additional Resources:

NCBI RefSeq record:
NM_015243.2
NBCI Gene record:
VPS13B (157680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381370 ATGGTACTCGCGCAGAATTTA pLKO_005 1631 CDS 100% 15.000 21.000 N VPS13B n/a
2 TRCN0000083957 CTGCCTATGTTTATTCGTATA pLKO.1 922 CDS 100% 10.800 15.120 N VPS13B n/a
3 TRCN0000083955 CGGATCTACAGCTTTCACTAT pLKO.1 182 CDS 100% 4.950 6.930 N VPS13B n/a
4 TRCN0000083953 GCCTTACTCAACCTTCTGATA pLKO.1 2261 CDS 100% 4.950 6.930 N VPS13B n/a
5 TRCN0000083954 CGCGCAGAATTTATCTTGGAT pLKO.1 1639 CDS 100% 3.000 4.200 N VPS13B n/a
6 TRCN0000256669 ATCGTGCATTCATGGATATTT pLKO_005 668 CDS 100% 15.000 12.000 N Vps13b n/a
7 TRCN0000379446 GCAAGTTGAGAGTAGTTATTA pLKO_005 1329 CDS 100% 15.000 12.000 N VPS13B n/a
8 TRCN0000083956 CCTTACTCAACCTTCTGATAA pLKO.1 2262 CDS 100% 13.200 9.240 N VPS13B n/a
9 TRCN0000382129 TGCTTACCTGTACCAGTTATT pLKO_005 2371 CDS 100% 13.200 9.240 N VPS13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.