Transcript: Human NM_015317.4

Homo sapiens pumilio RNA binding family member 2 (PUM2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PUM2 (23369)
Length:
6333
CDS:
267..3461

Additional Resources:

NCBI RefSeq record:
NM_015317.4
NBCI Gene record:
PUM2 (23369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015317.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296987 CCTAATCCTACAGCTAATAAA pLKO_005 876 CDS 100% 15.000 21.000 N PUM2 n/a
2 TRCN0000061861 GCTCCCAGAGTAGTTCTTTAT pLKO.1 1861 CDS 100% 13.200 10.560 N PUM2 n/a
3 TRCN0000291397 GCTCCCAGAGTAGTTCTTTAT pLKO_005 1861 CDS 100% 13.200 10.560 N PUM2 n/a
4 TRCN0000233379 CTAGCTCCAACTGCCTATTAT pLKO_005 1569 CDS 100% 15.000 10.500 N Pum2 n/a
5 TRCN0000297020 CTAGCTCCAACTGCCTATTAT pLKO_005 1569 CDS 100% 15.000 10.500 N PUM2 n/a
6 TRCN0000233376 TTCAATGTCCCAGCCTATTAT pLKO_005 431 CDS 100% 15.000 10.500 N Pum2 n/a
7 TRCN0000296921 CATTACTACTTTGCGCAAATA pLKO_005 3341 CDS 100% 13.200 9.240 N PUM2 n/a
8 TRCN0000061859 CCCAATACTAATCCCTCAGAA pLKO.1 840 CDS 100% 4.950 3.465 N PUM2 n/a
9 TRCN0000061860 CCATTCAATGTCCCAGCCTAT pLKO.1 428 CDS 100% 4.050 2.835 N PUM2 n/a
10 TRCN0000061862 CGTGGTCATGTTCTACCCTTA pLKO.1 2664 CDS 100% 4.050 2.835 N PUM2 n/a
11 TRCN0000061858 GCCGCGTTATTCAGAAAGCAT pLKO.1 2704 CDS 100% 3.000 2.100 N PUM2 n/a
12 TRCN0000296986 TTGACTTTATTCATCCATTTG pLKO_005 3582 3UTR 100% 10.800 6.480 N PUM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015317.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.