Transcript: Human NM_015322.5

Homo sapiens fem-1 homolog B (FEM1B), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
FEM1B (10116)
Length:
7177
CDS:
674..2557

Additional Resources:

NCBI RefSeq record:
NM_015322.5
NBCI Gene record:
FEM1B (10116)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015322.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303746 GACATACCACTATCTATATTT pLKO_005 1486 CDS 100% 15.000 21.000 N FEM1B n/a
2 TRCN0000060581 GCTCACACTGACATGACGAAT pLKO.1 2363 CDS 100% 4.950 6.930 N FEM1B n/a
3 TRCN0000303677 CCTAATGATTGCGGCATATAA pLKO_005 1144 CDS 100% 15.000 12.000 N FEM1B n/a
4 TRCN0000303647 ACGCTTGCTCTTAGAACATTA pLKO_005 859 CDS 100% 13.200 9.240 N FEM1B n/a
5 TRCN0000060579 CCTTCATATTATCGTTCAGTA pLKO.1 2278 CDS 100% 4.950 3.465 N FEM1B n/a
6 TRCN0000060582 CCATTGAAAGTAGCTGCCGAA pLKO.1 1337 CDS 100% 2.160 1.512 N FEM1B n/a
7 TRCN0000303679 GAGCTGTTTATGCGGATAATA pLKO_005 1725 CDS 100% 15.000 9.000 N FEM1B n/a
8 TRCN0000060580 GCCATGTTAGAGAGGTTCCAA pLKO.1 1508 CDS 100% 3.000 1.800 N FEM1B n/a
9 TRCN0000299671 GCCATGTTAGAGAGGTTCCAA pLKO_005 1508 CDS 100% 3.000 1.800 N FEM1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015322.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.