Transcript: Human NM_015419.4

Homo sapiens matrix remodeling associated 5 (MXRA5), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MXRA5 (25878)
Length:
9804
CDS:
167..8653

Additional Resources:

NCBI RefSeq record:
NM_015419.4
NBCI Gene record:
MXRA5 (25878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015419.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073409 GCCCTTATGATTCCTTAGATT pLKO.1 4029 CDS 100% 5.625 7.875 N MXRA5 n/a
2 TRCN0000073410 CCCTTATGATTCCTTAGATTA pLKO.1 4030 CDS 100% 13.200 10.560 N MXRA5 n/a
3 TRCN0000073408 GCGATATTAGATTTCCTTGTA pLKO.1 9497 3UTR 100% 4.950 3.465 N MXRA5 n/a
4 TRCN0000073411 GCTCGAAATAAGGTTGGTGAT pLKO.1 6833 CDS 100% 4.050 2.835 N MXRA5 n/a
5 TRCN0000073412 CCTGCGATTGTGAGATGAGAT pLKO.1 825 CDS 100% 4.950 2.970 N MXRA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015419.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.