Transcript: Human NM_015425.6

Homo sapiens RNA polymerase I subunit A (POLR1A), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLR1A (25885)
Length:
12480
CDS:
111..5273

Additional Resources:

NCBI RefSeq record:
NM_015425.6
NBCI Gene record:
POLR1A (25885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015425.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236281 TACATCAACACCAACGAAATT pLKO_005 1458 CDS 100% 13.200 18.480 N POLR1A n/a
2 TRCN0000236277 GACGAGATGAATGCCCATTTC pLKO_005 1884 CDS 100% 10.800 15.120 N POLR1A n/a
3 TRCN0000053085 CCACCCGTTCATAGATGACTA pLKO.1 4634 CDS 100% 4.950 6.930 N POLR1A n/a
4 TRCN0000236278 TTCACCCGGGAGCACTATATG pLKO_005 2052 CDS 100% 13.200 10.560 N POLR1A n/a
5 TRCN0000053083 CCTCTGAAATTCGGGAGGAAT pLKO.1 571 CDS 100% 4.950 3.960 N POLR1A n/a
6 TRCN0000236279 GCCAACTGCAAGGCCTATAAT pLKO_005 1848 CDS 100% 15.000 10.500 N POLR1A n/a
7 TRCN0000236280 TCTAGCACCAGCAATACATTT pLKO_005 6184 3UTR 100% 13.200 9.240 N POLR1A n/a
8 TRCN0000053084 GCTGCATTAAACCTGCCAGAA pLKO.1 2595 CDS 100% 4.050 2.835 N POLR1A n/a
9 TRCN0000053087 GCAATGAGATTAACAAGGCAT pLKO.1 2728 CDS 100% 2.640 1.848 N POLR1A n/a
10 TRCN0000053086 CCCACTGAACTTATCTGGAAA pLKO.1 2213 CDS 100% 4.950 2.970 N POLR1A n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 12381 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015425.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.