Transcript: Human NM_015456.5

Homo sapiens negative elongation factor complex member B (NELFB), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
NELFB (25920)
Length:
2540
CDS:
40..1926

Additional Resources:

NCBI RefSeq record:
NM_015456.5
NBCI Gene record:
NELFB (25920)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015456.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146389 CCATAGAAAGCGTGCTCATTT pLKO.1 2158 3UTR 100% 13.200 18.480 N NELFB n/a
2 TRCN0000330945 CCATAGAAAGCGTGCTCATTT pLKO_005 2158 3UTR 100% 13.200 18.480 N NELFB n/a
3 TRCN0000330946 CCGAAAGCTTCACTAAGTTTC pLKO_005 1406 CDS 100% 10.800 15.120 N NELFB n/a
4 TRCN0000148549 CCAGTCTCATATCCAAACACA pLKO.1 1381 CDS 100% 3.000 4.200 N NELFB n/a
5 TRCN0000146951 CACTTTCAATGTGGATCAGAA pLKO.1 1338 CDS 100% 4.950 3.465 N NELFB n/a
6 TRCN0000330872 CACTTTCAATGTGGATCAGAA pLKO_005 1338 CDS 100% 4.950 3.465 N NELFB n/a
7 TRCN0000148218 GTCTCATATCCAAACACACTT pLKO.1 1384 CDS 100% 4.950 3.465 N NELFB n/a
8 TRCN0000330873 GTCTCATATCCAAACACACTT pLKO_005 1384 CDS 100% 4.950 3.465 N NELFB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015456.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.