Transcript: Human NM_015513.6

Homo sapiens cysteine rich with EGF like domains 1 (CRELD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CRELD1 (78987)
Length:
2478
CDS:
389..1651

Additional Resources:

NCBI RefSeq record:
NM_015513.6
NBCI Gene record:
CRELD1 (78987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015513.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055759 TCTGGTATGTTCGGCTTGTTT pLKO.1 1012 CDS 100% 5.625 7.875 N CRELD1 n/a
2 TRCN0000371904 AGTGTGGCCTTGGCTACTTTG pLKO_005 969 CDS 100% 10.800 8.640 N CRELD1 n/a
3 TRCN0000055760 AGCTGACCAATTCTGCGTGAA pLKO.1 1159 CDS 100% 4.050 3.240 N CRELD1 n/a
4 TRCN0000371846 ACCTCAAGTGTGTAGACATTG pLKO_005 1107 CDS 100% 10.800 7.560 N CRELD1 n/a
5 TRCN0000371902 TCAGGACCTGAGGAATCAAAC pLKO_005 1052 CDS 100% 10.800 7.560 N CRELD1 n/a
6 TRCN0000055762 AGCAGGCTTCTTCTCAGAGAT pLKO.1 1441 CDS 100% 4.950 3.465 N CRELD1 n/a
7 TRCN0000109593 CTGCATCACCTCAAGTGTGTA pLKO.1 1100 CDS 100% 4.950 3.465 N Creld1 n/a
8 TRCN0000055758 GCAGATGTTCTTTGGCATCAT pLKO.1 1489 CDS 100% 4.950 3.465 N CRELD1 n/a
9 TRCN0000055761 AGGAAGAGAATTTGTCCAAAT pLKO.1 615 CDS 100% 10.800 6.480 N CRELD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015513.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.