Transcript: Human NM_015575.4

Homo sapiens GRB10 interacting GYF protein 2 (GIGYF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GIGYF2 (26058)
Length:
7928
CDS:
312..4211

Additional Resources:

NCBI RefSeq record:
NM_015575.4
NBCI Gene record:
GIGYF2 (26058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015575.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277089 TGCCCTTAATACGGCAAATAA pLKO_005 3743 CDS 100% 15.000 21.000 N Gigyf2 n/a
2 TRCN0000136361 CACAGTACACTCCATTCAGTA pLKO.1 4017 CDS 100% 4.950 6.930 N GIGYF2 n/a
3 TRCN0000133747 CAGGAAGAATTGTTACGCAAA pLKO.1 2817 CDS 100% 4.050 5.670 N GIGYF2 n/a
4 TRCN0000136339 GCAACAAATCACAGAACCGAT pLKO.1 4311 3UTR 100% 2.640 3.696 N GIGYF2 n/a
5 TRCN0000134463 GCATGAATTTATACGCTCAGA pLKO.1 890 CDS 100% 2.640 3.696 N GIGYF2 n/a
6 TRCN0000135088 CGGGAGCAAGAAATTGCATTA pLKO.1 2703 CDS 100% 10.800 8.640 N GIGYF2 n/a
7 TRCN0000414322 AGCAATGCAGAAGTGGTATTA pLKO_005 1904 CDS 100% 13.200 9.240 N GIGYF2 n/a
8 TRCN0000413048 TGATTATATCAGGGCCTATTT pLKO_005 3824 CDS 100% 13.200 9.240 N GIGYF2 n/a
9 TRCN0000135151 CGCATCTTTAGAGAGGAACAA pLKO.1 924 CDS 100% 4.950 3.465 N GIGYF2 n/a
10 TRCN0000138937 GCAACCAAACAGAGCTCGTAA pLKO.1 3383 CDS 100% 4.950 3.465 N GIGYF2 n/a
11 TRCN0000133792 CCATTCAGTATTTCAGACCAA pLKO.1 4028 CDS 100% 2.640 1.848 N GIGYF2 n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 7607 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015575.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.