Transcript: Mouse NM_015738.2

Mus musculus galanin receptor 3 (Galr3), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Galr3 (14429)
Length:
1245
CDS:
48..1160

Additional Resources:

NCBI RefSeq record:
NM_015738.2
NBCI Gene record:
Galr3 (14429)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015738.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028695 CTACGCCAACTCCTGCCTCAA pLKO.1 887 CDS 100% 1.350 0.945 N Galr3 n/a
2 TRCN0000028747 CGCTCGTCTATTCCCTTGCCT pLKO.1 910 CDS 100% 0.250 0.175 N Galr3 n/a
3 TRCN0000014499 CCTGCCTCAACCCGCTCGTCT pLKO.1 898 CDS 100% 0.000 0.000 N GALR3 n/a
4 TRCN0000028688 CTCATCTACCTCACCATGTAT pLKO.1 348 CDS 100% 5.625 2.813 Y Galr3 n/a
5 TRCN0000028675 GCGGCCATCTACACACTGGAT pLKO.1 285 CDS 100% 0.880 0.440 Y Galr3 n/a
6 TRCN0000028681 GCCGGTGGTCTTTGCCCTCAT pLKO.1 107 CDS 100% 0.000 0.000 Y Galr3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015738.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.