Transcript: Mouse NM_015742.2

Mus musculus myosin IXb (Myo9b), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Myo9b (17925)
Length:
7100
CDS:
171..6056

Additional Resources:

NCBI RefSeq record:
NM_015742.2
NBCI Gene record:
Myo9b (17925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025943 CCCTTTAAGTTCCTGCCCATT pLKO.1 732 CDS 100% 4.050 5.670 N Myo9b n/a
2 TRCN0000025897 CCGTAAGATCACTAATGCCAA pLKO.1 4553 CDS 100% 2.640 3.696 N Myo9b n/a
3 TRCN0000025920 CCGCGATTTGCATAACCAAAT pLKO.1 2387 CDS 100% 1.080 1.404 N Myo9b n/a
4 TRCN0000362502 GAAGCAGCCTCAAGACTATTT pLKO_005 1235 CDS 100% 13.200 9.240 N Myo9b n/a
5 TRCN0000362422 GTGTTCCGTAAGATCACTAAT pLKO_005 4548 CDS 100% 13.200 9.240 N Myo9b n/a
6 TRCN0000362423 TCCCTATACAGTGCCCTATTT pLKO_005 1620 CDS 100% 13.200 9.240 N Myo9b n/a
7 TRCN0000025934 CCCAAAGATAAGGACAAGGAT pLKO.1 3906 CDS 100% 3.000 2.100 N Myo9b n/a
8 TRCN0000362501 GGAGAAGGCAGCAGGTATAAG pLKO_005 2297 CDS 100% 13.200 7.920 N Myo9b n/a
9 TRCN0000025882 CCAGAGAACCTTCCAGAGATT pLKO.1 6822 3UTR 100% 4.950 2.970 N Myo9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015742.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.