Transcript: Mouse NM_015743.3

Mus musculus nuclear receptor subfamily 4, group A, member 3 (Nr4a3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Nr4a3 (18124)
Length:
5573
CDS:
592..2475

Additional Resources:

NCBI RefSeq record:
NM_015743.3
NBCI Gene record:
Nr4a3 (18124)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025995 GCAGACTTATGGCTCGGAATA pLKO.1 648 CDS 100% 10.800 15.120 N Nr4a3 n/a
2 TRCN0000025974 GCAGAGCCTGAACCTTGATAT pLKO.1 2166 CDS 100% 13.200 9.240 N Nr4a3 n/a
3 TRCN0000025982 CCCAAAGAAGATCAGACGTTA pLKO.1 1978 CDS 100% 4.950 3.465 N Nr4a3 n/a
4 TRCN0000025969 CGGCCTTTGATCAAGATGGAA pLKO.1 844 CDS 100% 3.000 2.100 N Nr4a3 n/a
5 TRCN0000025997 CCTCCGATCTGTATGATGAAT pLKO.1 1774 CDS 100% 5.625 3.375 N Nr4a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.