Transcript: Mouse NM_015769.2

Mus musculus excision repair cross-complementing rodent repair deficiency, complementation group 4 (Ercc4), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ercc4 (50505)
Length:
6703
CDS:
200..2953

Additional Resources:

NCBI RefSeq record:
NM_015769.2
NBCI Gene record:
Ercc4 (50505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240799 CTACACGCAGGGTGGTATTAT pLKO_005 499 CDS 100% 15.000 21.000 N Ercc4 n/a
2 TRCN0000240800 CCGAATACTCGTGGTTGATTT pLKO_005 532 CDS 100% 13.200 18.480 N Ercc4 n/a
3 TRCN0000257149 GAGATTAAGCGTGAATCATTT pLKO_005 1784 CDS 100% 13.200 18.480 N Ercc4 n/a
4 TRCN0000240798 CTGTTCTCACATGGCTATTTA pLKO_005 2954 CDS 100% 15.000 10.500 N Ercc4 n/a
5 TRCN0000175845 GCTGAAGAAGTGTGGGTAAAT pLKO.1 1535 CDS 100% 13.200 9.240 N Ercc4 n/a
6 TRCN0000174337 CTTGAAGTAAACACAGACTAT pLKO.1 3171 3UTR 100% 4.950 3.465 N Ercc4 n/a
7 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 5165 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.