Transcript: Mouse NM_015770.3

Mus musculus nonagouti (a), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
a (50518)
Length:
692
CDS:
83..478

Additional Resources:

NCBI RefSeq record:
NM_015770.3
NBCI Gene record:
a (50518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_015770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089076 CTCCATGAACTCGCTGGATTT pLKO.1 202 CDS 100% 10.800 15.120 N a n/a
2 TRCN0000089074 GCGGAGTAACTCCTCCATGAA pLKO.1 190 CDS 100% 4.950 3.960 N a n/a
3 TRCN0000089075 CGGAAGAGGTCTTCCAAGAAA pLKO.1 290 CDS 100% 0.563 0.450 N a n/a
4 TRCN0000436725 CAACTGCTGACGCAGCTTCTT pLKO_005 469 CDS 100% 4.950 3.465 N a n/a
5 TRCN0000428079 TGTGCTTCTTCACCGTCCACA pLKO_005 126 CDS 100% 2.640 1.848 N a n/a
6 TRCN0000089077 CTCCTGCCAGTGCCGTTTCTT pLKO.1 415 CDS 100% 1.875 1.313 N a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.