Transcript: Human NM_015842.2

Homo sapiens LIM domain 7 (LMO7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
LMO7 (4008)
Length:
6791
CDS:
761..4918

Additional Resources:

NCBI RefSeq record:
NM_015842.2
NBCI Gene record:
LMO7 (4008)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376396 AGTTGGGCAAGCCCGGTTTAT pLKO_005 929 CDS 100% 13.200 18.480 N LMO7 n/a
2 TRCN0000368960 CACAAAGCAACCCGTACTATA pLKO_005 444 5UTR 100% 13.200 18.480 N LMO7 n/a
3 TRCN0000368961 GAGAAGCTCTAAGACGTTTAA pLKO_005 2230 CDS 100% 13.200 18.480 N LMO7 n/a
4 TRCN0000364468 GTGACACAGATTCGGAATTTA pLKO_005 732 5UTR 100% 15.000 10.500 N LMO7 n/a
5 TRCN0000364469 AGAATTGGAGAGGCAACAAAT pLKO_005 4294 CDS 100% 13.200 9.240 N LMO7 n/a
6 TRCN0000368959 GTCTTGGTAGAACCAGTATTT pLKO_005 5003 3UTR 100% 13.200 9.240 N LMO7 n/a
7 TRCN0000006489 GCCTCTTTAGATTACATAGAA pLKO.1 4974 3UTR 100% 5.625 3.938 N LMO7 n/a
8 TRCN0000006492 GCTATTAACAACACCAAGTTT pLKO.1 3173 CDS 100% 5.625 3.938 N LMO7 n/a
9 TRCN0000006493 CCGGTTTATACAGAAGCAGAT pLKO.1 941 CDS 100% 4.050 2.835 N LMO7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.