Transcript: Human NM_015866.4

Homo sapiens PR/SET domain 2 (PRDM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PRDM2 (7799)
Length:
7466
CDS:
857..5905

Additional Resources:

NCBI RefSeq record:
NM_015866.4
NBCI Gene record:
PRDM2 (7799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015866.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230071 ACAGCGGATGCGGAGATTAAA pLKO_005 5405 CDS 100% 15.000 21.000 N PRDM2 n/a
2 TRCN0000230070 AGAGCTTTACACGACTATAAA pLKO_005 4657 CDS 100% 15.000 21.000 N PRDM2 n/a
3 TRCN0000013102 CGTCGAATAAGCTCAAATTAA pLKO.1 5094 CDS 100% 15.000 21.000 N PRDM2 n/a
4 TRCN0000013100 GCCTACGTGTAGTGCTGTAAA pLKO.1 3472 CDS 100% 13.200 18.480 N PRDM2 n/a
5 TRCN0000013099 CCGTCAATCATGCTTTCAAAT pLKO.1 2010 CDS 100% 13.200 10.560 N PRDM2 n/a
6 TRCN0000230069 GGCAGATTTGTATGGTATAAA pLKO_005 2632 CDS 100% 15.000 10.500 N PRDM2 n/a
7 TRCN0000218082 GTCACATGCATATCCATATAT pLKO_005 1986 CDS 100% 15.000 10.500 N PRDM2 n/a
8 TRCN0000013101 CCTCTGCAAATATGAGAGATT pLKO.1 1449 CDS 100% 4.950 3.465 N PRDM2 n/a
9 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 1697 CDS 100% 4.950 2.475 Y SET n/a
10 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 1697 CDS 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015866.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.