Transcript: Human NM_015902.6

Homo sapiens ubiquitin protein ligase E3 component n-recognin 5 (UBR5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
UBR5 (51366)
Length:
10895
CDS:
467..8866

Additional Resources:

NCBI RefSeq record:
NM_015902.6
NBCI Gene record:
UBR5 (51366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015902.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226458 TTGGAACAGGCTACTATTAAA pLKO_005 593 CDS 100% 15.000 21.000 N UBR5 n/a
2 TRCN0000226460 CATTGAGCTCTAGGATATTAA pLKO_005 9425 3UTR 100% 15.000 10.500 N UBR5 n/a
3 TRCN0000003409 TGACAGCAGAACAACATAATT pLKO.1 9105 3UTR 100% 15.000 10.500 N UBR5 n/a
4 TRCN0000003411 GCTCGTCTTGATCTACTTTAT pLKO.1 4214 CDS 100% 13.200 9.240 N UBR5 n/a
5 TRCN0000218934 TAGCAACATTTGGCTATATTG pLKO_005 9042 3UTR 100% 13.200 9.240 N UBR5 n/a
6 TRCN0000226461 TTCAGTTCTAACTAGACATTT pLKO_005 9602 3UTR 100% 13.200 9.240 N UBR5 n/a
7 TRCN0000226459 TTGCTGAGTTTATAGCTTAAA pLKO_005 9007 3UTR 100% 13.200 9.240 N UBR5 n/a
8 TRCN0000003408 GCTGTAGATTTCAACTTAGAT pLKO.1 2178 CDS 100% 5.625 3.938 N UBR5 n/a
9 TRCN0000003412 GCCATTAGAAAGAACCACAAA pLKO.1 5545 CDS 100% 4.950 3.465 N UBR5 n/a
10 TRCN0000003410 GCCTTACAGAAATGCCCAGAA pLKO.1 1663 CDS 100% 4.050 2.835 N UBR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015902.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.