Transcript: Human NM_015944.4

Homo sapiens amidohydrolase domain containing 2 (AMDHD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
AMDHD2 (51005)
Length:
3262
CDS:
89..1408

Additional Resources:

NCBI RefSeq record:
NM_015944.4
NBCI Gene record:
AMDHD2 (51005)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046928 CGGTGGATTTGGTGTTGACTT pLKO.1 307 CDS 100% 4.950 6.930 N AMDHD2 n/a
2 TRCN0000046932 CGTGCAGATCAACGGTGGATT pLKO.1 295 CDS 100% 4.950 6.930 N AMDHD2 n/a
3 TRCN0000046929 GAGGTTTATCACAAGGTTGTT pLKO.1 434 CDS 100% 4.950 6.930 N AMDHD2 n/a
4 TRCN0000427330 TTTGGTGCTGACGCAGACTTC pLKO_005 1304 CDS 100% 4.050 5.670 N AMDHD2 n/a
5 TRCN0000046931 CCAGTTCACTAACTGCCGGAT pLKO.1 127 CDS 100% 0.216 0.302 N AMDHD2 n/a
6 TRCN0000032760 GTGCAGATCAACGGTGGATTT pLKO.1 296 CDS 100% 10.800 7.560 N Amdhd2 n/a
7 TRCN0000046930 TGCATCTTCTATGGGATGATT pLKO.1 869 CDS 100% 5.625 3.938 N AMDHD2 n/a
8 TRCN0000431463 ATCCCTGTGAAGAGTGGTGGT pLKO_005 461 CDS 100% 2.160 1.512 N AMDHD2 n/a
9 TRCN0000434581 ACGTCCAGGCCACCTACATCT pLKO_005 1347 CDS 100% 1.650 1.155 N AMDHD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015944.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.