Transcript: Human NM_015990.4

Homo sapiens kelch like family member 5 (KLHL5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
KLHL5 (51088)
Length:
7728
CDS:
284..2551

Additional Resources:

NCBI RefSeq record:
NM_015990.4
NBCI Gene record:
KLHL5 (51088)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015990.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423958 AGACGGAAAGATCTAAGTAAA pLKO_005 1475 CDS 100% 13.200 18.480 N KLHL5 n/a
2 TRCN0000418246 AGATCCATGTAGCCTACAATT pLKO_005 583 CDS 100% 13.200 18.480 N KLHL5 n/a
3 TRCN0000116330 CCAATAGTAGTCAGACATTAT pLKO.1 810 CDS 100% 13.200 18.480 N KLHL5 n/a
4 TRCN0000427863 TATTACCAGCCAGCGAAATTG pLKO_005 1362 CDS 100% 13.200 18.480 N KLHL5 n/a
5 TRCN0000116327 CCTGCCTTATTTCTTATGTTT pLKO.1 3449 3UTR 100% 5.625 3.938 N KLHL5 n/a
6 TRCN0000116331 CTTGTCTCAAATCAGTAGAAT pLKO.1 2142 CDS 100% 5.625 3.938 N KLHL5 n/a
7 TRCN0000116329 GCTAGTGATGACATGAACATT pLKO.1 1394 CDS 100% 5.625 3.938 N KLHL5 n/a
8 TRCN0000116328 CCCTTAATCATGCCGAGCAAA pLKO.1 879 CDS 100% 4.950 3.465 N KLHL5 n/a
9 TRCN0000434441 AGTCAACTGTTGGTACATTAT pLKO_005 1671 CDS 100% 13.200 7.920 N KLHL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015990.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.