Transcript: Human NM_016086.2

Homo sapiens serine/threonine/tyrosine interacting like 1 (STYXL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
STYXL1 (51657)
Length:
1429
CDS:
344..1285

Additional Resources:

NCBI RefSeq record:
NM_016086.2
NBCI Gene record:
STYXL1 (51657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381024 TCCGTTCCAAATGGGAGTATG pLKO_005 450 CDS 100% 10.800 15.120 N STYXL1 n/a
2 TRCN0000380153 TGAAGTACTGCGTGGTGTATG pLKO_005 555 CDS 100% 10.800 15.120 N STYXL1 n/a
3 TRCN0000003054 GCATAGTAACGAGCAGACCTT pLKO.1 1129 CDS 100% 2.640 2.112 N STYXL1 n/a
4 TRCN0000381875 GCCTACCTCATGCATAGTAAC pLKO_005 1118 CDS 100% 10.800 7.560 N STYXL1 n/a
5 TRCN0000003056 GCTGGAATGGGAGAAGACTAT pLKO.1 1222 CDS 100% 4.950 3.465 N STYXL1 n/a
6 TRCN0000280093 GCTGGAATGGGAGAAGACTAT pLKO_005 1222 CDS 100% 4.950 3.465 N STYXL1 n/a
7 TRCN0000003055 GCTTTACAACATCCTGAATCA pLKO.1 376 CDS 100% 4.950 3.465 N STYXL1 n/a
8 TRCN0000280094 GCTTTACAACATCCTGAATCA pLKO_005 376 CDS 100% 4.950 3.465 N STYXL1 n/a
9 TRCN0000003053 TCTTCCCTTCTTACGCCACAT pLKO.1 1006 CDS 100% 4.050 2.835 N STYXL1 n/a
10 TRCN0000280025 TCTTCCCTTCTTACGCCACAT pLKO_005 1006 CDS 100% 4.050 2.835 N STYXL1 n/a
11 TRCN0000003052 GAGGGCCAGAGTGTGTATACC pLKO.1 1346 3UTR 100% 1.650 0.990 N STYXL1 n/a
12 TRCN0000297757 GAGGGCCAGAGTGTGTATACC pLKO_005 1346 3UTR 100% 1.650 0.990 N STYXL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.