Transcript: Human NM_016155.7

Homo sapiens matrix metallopeptidase 17 (MMP17), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
MMP17 (4326)
Length:
2411
CDS:
103..1914

Additional Resources:

NCBI RefSeq record:
NM_016155.7
NBCI Gene record:
MMP17 (4326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016155.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437177 ACGCAAGAGGAGCTGTCTAAG pLKO_005 322 CDS 100% 10.800 8.640 N MMP17 n/a
2 TRCN0000049975 ACTCATGTACTACGCCCTCAA pLKO.1 576 CDS 100% 4.050 3.240 N MMP17 n/a
3 TRCN0000049977 GTGGCTAAGCAGGTTCGGTTA pLKO.1 264 CDS 100% 4.050 3.240 N MMP17 n/a
4 TRCN0000433678 ACTGGGTGTTCAAGGACAATA pLKO_005 1316 CDS 100% 13.200 9.240 N MMP17 n/a
5 TRCN0000049973 GCCCACAATGACAGGACTTAT pLKO.1 1414 CDS 100% 13.200 9.240 N MMP17 n/a
6 TRCN0000049974 CGACCACAAGATCGTCTTCTT pLKO.1 1281 CDS 100% 4.950 3.465 N MMP17 n/a
7 TRCN0000032870 CTCATGTACTACGCCCTCAAA pLKO.1 577 CDS 100% 4.950 3.960 N Mmp17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016155.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.