Transcript: Human NM_016195.3

Homo sapiens kinesin family member 20B (KIF20B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
KIF20B (9585)
Length:
6339
CDS:
93..5435

Additional Resources:

NCBI RefSeq record:
NM_016195.3
NBCI Gene record:
KIF20B (9585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296536 ACGGAGTCAGGCATCCATAAT pLKO_005 5102 CDS 100% 13.200 18.480 N KIF20B n/a
2 TRCN0000116810 CGACCGAACATTGCAGAAATT pLKO.1 2574 CDS 100% 13.200 18.480 N KIF20B n/a
3 TRCN0000116807 GCTATCAGATAGTAGATCATT pLKO.1 6143 3UTR 100% 5.625 4.500 N KIF20B n/a
4 TRCN0000290166 GCTATCAGATAGTAGATCATT pLKO_005 6143 3UTR 100% 5.625 4.500 N KIF20B n/a
5 TRCN0000296594 AGTAGAAGTCACAGCATATTC pLKO_005 1137 CDS 100% 13.200 9.240 N KIF20B n/a
6 TRCN0000116809 CCTCGAACTTTGAATGTATTA pLKO.1 609 CDS 100% 13.200 9.240 N KIF20B n/a
7 TRCN0000290238 CCTCGAACTTTGAATGTATTA pLKO_005 609 CDS 100% 13.200 9.240 N KIF20B n/a
8 TRCN0000116808 GCCTCGAACTTTGAATGTATT pLKO.1 608 CDS 100% 13.200 9.240 N KIF20B n/a
9 TRCN0000116811 GCGACCGAACATTGCAGAAAT pLKO.1 2573 CDS 100% 13.200 9.240 N KIF20B n/a
10 TRCN0000290237 GCGACCGAACATTGCAGAAAT pLKO_005 2573 CDS 100% 13.200 9.240 N KIF20B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016195.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.