Transcript: Human NM_016356.5

Homo sapiens doublecortin domain containing 2 (DCDC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DCDC2 (51473)
Length:
4715
CDS:
310..1740

Additional Resources:

NCBI RefSeq record:
NM_016356.5
NBCI Gene record:
DCDC2 (51473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016356.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154233 CCTAGTGGAAAGACCAGATAA pLKO.1 1877 3UTR 100% 13.200 18.480 N DCDC2 n/a
2 TRCN0000157028 GCCGTGCACTATCTTCTTGAT pLKO.1 720 CDS 100% 4.950 6.930 N DCDC2 n/a
3 TRCN0000153188 GCAGAAATAGTAGACGAGGAA pLKO.1 1339 CDS 100% 2.640 2.112 N DCDC2 n/a
4 TRCN0000153518 CCGTGCACTATCTTCTTGATT pLKO.1 721 CDS 100% 5.625 3.938 N DCDC2 n/a
5 TRCN0000151206 GAGTATATGGATCGCAAGAAA pLKO.1 1757 3UTR 100% 5.625 3.938 N DCDC2 n/a
6 TRCN0000152723 CAGTGGGATCATGTACTACAA pLKO.1 802 CDS 100% 4.950 3.465 N DCDC2 n/a
7 TRCN0000151230 GAATTTGCACTGGAAGACAAT pLKO.1 1987 3UTR 100% 4.950 3.465 N DCDC2 n/a
8 TRCN0000157255 GCTGATGTAGACCCTCAAAGA pLKO.1 1636 CDS 100% 4.950 3.465 N DCDC2 n/a
9 TRCN0000151568 GTACTACAAATGGTCACAGAA pLKO.1 814 CDS 100% 4.950 3.465 N DCDC2 n/a
10 TRCN0000156860 GTGGAAATGATCGCCACTCTA pLKO.1 1067 CDS 100% 4.950 3.465 N DCDC2 n/a
11 TRCN0000152139 CCAAATAGTGATGAAGGCATT pLKO.1 1222 CDS 100% 4.050 2.835 N DCDC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016356.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.