Transcript: Human NM_016445.3

Homo sapiens pleckstrin 2 (PLEK2), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PLEK2 (26499)
Length:
1513
CDS:
107..1168

Additional Resources:

NCBI RefSeq record:
NM_016445.3
NBCI Gene record:
PLEK2 (26499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108305 CCTGGAGAATGGGAGTGTTAA pLKO.1 1226 3UTR 100% 13.200 9.240 N PLEK2 n/a
2 TRCN0000311626 CCTGGAGAATGGGAGTGTTAA pLKO_005 1226 3UTR 100% 13.200 9.240 N PLEK2 n/a
3 TRCN0000108306 CCAGCTTTCCTGCATTACTAT pLKO.1 929 CDS 100% 5.625 3.938 N PLEK2 n/a
4 TRCN0000311624 CCAGCTTTCCTGCATTACTAT pLKO_005 929 CDS 100% 5.625 3.938 N PLEK2 n/a
5 TRCN0000108307 GCATCGCATTGTGGACAAGAT pLKO.1 493 CDS 100% 4.950 3.465 N PLEK2 n/a
6 TRCN0000311623 GCATCGCATTGTGGACAAGAT pLKO_005 493 CDS 100% 4.950 3.465 N PLEK2 n/a
7 TRCN0000108309 GCTCTGGAAGATAATGGCGTT pLKO.1 1013 CDS 100% 2.160 1.512 N PLEK2 n/a
8 TRCN0000108308 ACCTCTTCAAAGTGATTACTA pLKO.1 1065 CDS 100% 5.625 3.375 N PLEK2 n/a
9 TRCN0000311625 ACCTCTTCAAAGTGATTACTA pLKO_005 1065 CDS 100% 5.625 3.375 N PLEK2 n/a
10 TRCN0000306395 AGGATGACACACACTATTATA pLKO_005 1086 CDS 100% 15.000 10.500 N Plek2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016445.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.