Transcript: Human NM_016643.3

Homo sapiens zinc finger protein 771 (ZNF771), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
ZNF771 (51333)
Length:
1473
CDS:
274..1227

Additional Resources:

NCBI RefSeq record:
NM_016643.3
NBCI Gene record:
ZNF771 (51333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107432 CGCCTAAGCTCGCACTTCATT pLKO.1 1078 CDS 100% 5.625 7.875 N ZNF771 n/a
2 TRCN0000107430 CCCGTGTTAGTGAATAAAGTA pLKO.1 1424 3UTR 100% 5.625 4.500 N ZNF771 n/a
3 TRCN0000095480 GAGAAGTATGAGGTGGTGAAA pLKO.1 367 CDS 100% 4.950 3.465 N Zfp771 n/a
4 TRCN0000107431 CCGCCTAAGCTCGCACTTCAT pLKO.1 1077 CDS 100% 1.650 1.155 N ZNF771 n/a
5 TRCN0000107434 CGGGCGAGAAGCCGTACGCAT pLKO.1 698 CDS 100% 0.000 0.000 Y ZNF771 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.